ID: 1116672412

View in Genome Browser
Species Human (GRCh38)
Location 14:47860509-47860531
Sequence CAGGACAAGGAGTAGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116672406_1116672412 7 Left 1116672406 14:47860479-47860501 CCTAGTTATTTTGCCTAGGGTGT No data
Right 1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG No data
1116672409_1116672412 -6 Left 1116672409 14:47860492-47860514 CCTAGGGTGTAGGTCTACAGGAC No data
Right 1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116672412 Original CRISPR CAGGACAAGGAGTAGTGGTC AGG Intergenic
No off target data available for this crispr