ID: 1116674361

View in Genome Browser
Species Human (GRCh38)
Location 14:47886791-47886813
Sequence GAGTGGTCTTTCCTGTGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116674356_1116674361 25 Left 1116674356 14:47886743-47886765 CCATCTTTCTTGCTTGCAAATGG No data
Right 1116674361 14:47886791-47886813 GAGTGGTCTTTCCTGTGTATGGG No data
1116674358_1116674361 -1 Left 1116674358 14:47886769-47886791 CCTTCTTACTGTATTCTCAAGTG No data
Right 1116674361 14:47886791-47886813 GAGTGGTCTTTCCTGTGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116674361 Original CRISPR GAGTGGTCTTTCCTGTGTAT GGG Intergenic
No off target data available for this crispr