ID: 1116674381

View in Genome Browser
Species Human (GRCh38)
Location 14:47886962-47886984
Sequence CTGTGGCTATATTTGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116674381_1116674391 11 Left 1116674381 14:47886962-47886984 CCCATGTCCAAATATAGCCACAG No data
Right 1116674391 14:47886996-47887018 GCTTCGACATATGTATTTTGGGG No data
1116674381_1116674389 9 Left 1116674381 14:47886962-47886984 CCCATGTCCAAATATAGCCACAG No data
Right 1116674389 14:47886994-47887016 GGGCTTCGACATATGTATTTTGG No data
1116674381_1116674390 10 Left 1116674381 14:47886962-47886984 CCCATGTCCAAATATAGCCACAG No data
Right 1116674390 14:47886995-47887017 GGCTTCGACATATGTATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116674381 Original CRISPR CTGTGGCTATATTTGGACAT GGG (reversed) Intergenic
No off target data available for this crispr