ID: 1116677411

View in Genome Browser
Species Human (GRCh38)
Location 14:47923604-47923626
Sequence GAATTCTGGTGTGGTGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116677411_1116677415 -4 Left 1116677411 14:47923604-47923626 CCCTTTGCACCACACCAGAATTC No data
Right 1116677415 14:47923623-47923645 ATTCATTATTGCCTGTCTTTTGG 0: 56
1: 135
2: 736
3: 977
4: 1029

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116677411 Original CRISPR GAATTCTGGTGTGGTGCAAA GGG (reversed) Intergenic
No off target data available for this crispr