ID: 1116677415

View in Genome Browser
Species Human (GRCh38)
Location 14:47923623-47923645
Sequence ATTCATTATTGCCTGTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2933
Summary {0: 56, 1: 135, 2: 736, 3: 977, 4: 1029}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116677409_1116677415 18 Left 1116677409 14:47923582-47923604 CCACCAACATTGTAGGAAGCTTC No data
Right 1116677415 14:47923623-47923645 ATTCATTATTGCCTGTCTTTTGG 0: 56
1: 135
2: 736
3: 977
4: 1029
1116677411_1116677415 -4 Left 1116677411 14:47923604-47923626 CCCTTTGCACCACACCAGAATTC No data
Right 1116677415 14:47923623-47923645 ATTCATTATTGCCTGTCTTTTGG 0: 56
1: 135
2: 736
3: 977
4: 1029
1116677410_1116677415 15 Left 1116677410 14:47923585-47923607 CCAACATTGTAGGAAGCTTCCCT No data
Right 1116677415 14:47923623-47923645 ATTCATTATTGCCTGTCTTTTGG 0: 56
1: 135
2: 736
3: 977
4: 1029
1116677412_1116677415 -5 Left 1116677412 14:47923605-47923627 CCTTTGCACCACACCAGAATTCA No data
Right 1116677415 14:47923623-47923645 ATTCATTATTGCCTGTCTTTTGG 0: 56
1: 135
2: 736
3: 977
4: 1029
1116677408_1116677415 19 Left 1116677408 14:47923581-47923603 CCCACCAACATTGTAGGAAGCTT No data
Right 1116677415 14:47923623-47923645 ATTCATTATTGCCTGTCTTTTGG 0: 56
1: 135
2: 736
3: 977
4: 1029

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116677415 Original CRISPR ATTCATTATTGCCTGTCTTT TGG Intergenic
Too many off-targets to display for this crispr