ID: 1116677833

View in Genome Browser
Species Human (GRCh38)
Location 14:47927812-47927834
Sequence AGGCAAGAGTTCAAGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116677833_1116677841 14 Left 1116677833 14:47927812-47927834 CCCAGATTCTTGAACTCTTGCCT No data
Right 1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG No data
1116677833_1116677840 7 Left 1116677833 14:47927812-47927834 CCCAGATTCTTGAACTCTTGCCT No data
Right 1116677840 14:47927842-47927864 AGAATCAGAAAGTGTCCAGAGGG No data
1116677833_1116677839 6 Left 1116677833 14:47927812-47927834 CCCAGATTCTTGAACTCTTGCCT No data
Right 1116677839 14:47927841-47927863 CAGAATCAGAAAGTGTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116677833 Original CRISPR AGGCAAGAGTTCAAGAATCT GGG (reversed) Intergenic
No off target data available for this crispr