ID: 1116677837

View in Genome Browser
Species Human (GRCh38)
Location 14:47927832-47927854
Sequence ACTTTCTGATTCTGGTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116677837_1116677841 -6 Left 1116677837 14:47927832-47927854 CCTAGGGACCAGAATCAGAAAGT No data
Right 1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116677837 Original CRISPR ACTTTCTGATTCTGGTCCCT AGG (reversed) Intergenic
No off target data available for this crispr