ID: 1116681974

View in Genome Browser
Species Human (GRCh38)
Location 14:47983842-47983864
Sequence ATGGACAAAAGAGCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116681966_1116681974 22 Left 1116681966 14:47983797-47983819 CCCTGTTCATATTCTCCCAAAGC No data
Right 1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG No data
1116681969_1116681974 6 Left 1116681969 14:47983813-47983835 CCAAAGCAACTATAATTTCACAG No data
Right 1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG No data
1116681968_1116681974 7 Left 1116681968 14:47983812-47983834 CCCAAAGCAACTATAATTTCACA No data
Right 1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG No data
1116681967_1116681974 21 Left 1116681967 14:47983798-47983820 CCTGTTCATATTCTCCCAAAGCA No data
Right 1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116681974 Original CRISPR ATGGACAAAAGAGCCTTTGT GGG Intergenic
No off target data available for this crispr