ID: 1116683794

View in Genome Browser
Species Human (GRCh38)
Location 14:48011733-48011755
Sequence CCCGGCGGGTACCCCGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116683794_1116683801 -9 Left 1116683794 14:48011733-48011755 CCGGACTCGGGGTACCCGCCGGG No data
Right 1116683801 14:48011747-48011769 CCCGCCGGGTGGTGTGGGGCTGG No data
1116683794_1116683804 15 Left 1116683794 14:48011733-48011755 CCGGACTCGGGGTACCCGCCGGG No data
Right 1116683804 14:48011771-48011793 TTCCCCACCAAGTTACTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116683794 Original CRISPR CCCGGCGGGTACCCCGAGTC CGG (reversed) Intergenic