ID: 1116683801

View in Genome Browser
Species Human (GRCh38)
Location 14:48011747-48011769
Sequence CCCGCCGGGTGGTGTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 6, 1: 21, 2: 29, 3: 53, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116683792_1116683801 -6 Left 1116683792 14:48011730-48011752 CCGCCGGACTCGGGGTACCCGCC No data
Right 1116683801 14:48011747-48011769 CCCGCCGGGTGGTGTGGGGCTGG 0: 6
1: 21
2: 29
3: 53
4: 369
1116683789_1116683801 3 Left 1116683789 14:48011721-48011743 CCTTTGTCTCCGCCGGACTCGGG No data
Right 1116683801 14:48011747-48011769 CCCGCCGGGTGGTGTGGGGCTGG 0: 6
1: 21
2: 29
3: 53
4: 369
1116683794_1116683801 -9 Left 1116683794 14:48011733-48011755 CCGGACTCGGGGTACCCGCCGGG No data
Right 1116683801 14:48011747-48011769 CCCGCCGGGTGGTGTGGGGCTGG 0: 6
1: 21
2: 29
3: 53
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116683801 Original CRISPR CCCGCCGGGTGGTGTGGGGC TGG Intergenic
900284011 1:1890726-1890748 ACCGGCGGGTGGGGTGGGGGCGG + Intronic
900305294 1:2003800-2003822 CCGGCGGCGTGGTTTGGGGCGGG + Exonic
900394869 1:2449142-2449164 ACCTCTGGGTGGTGGGGGGCGGG - Intronic
900408721 1:2503538-2503560 GGGGCAGGGTGGTGTGGGGCGGG - Intronic
900661058 1:3783965-3783987 CGTGCCTGGTGGGGTGGGGCCGG - Intronic
900818777 1:4870433-4870455 CCAGCAGAGTGGTGTGGGGCAGG + Intergenic
900996536 1:6126237-6126259 CCCCCCGGGAGGTGGGGGCCAGG - Intronic
901489887 1:9591301-9591323 ACAGCCGGGTGATGTGGGGCAGG - Intronic
901828970 1:11880564-11880586 CCAGCTGGGTGGGGCGGGGCGGG - Intergenic
902626826 1:17681607-17681629 TCGGCCAGGTGCTGTGGGGCTGG + Intronic
902650251 1:17832678-17832700 CCCCCAGGGAGGTGGGGGGCAGG + Intergenic
902805817 1:18860686-18860708 CCAGCCATGTGGTGTGTGGCAGG - Intronic
903309411 1:22442611-22442633 CCCTCCGGGTGGCATGGGGGAGG - Intergenic
904769418 1:32872541-32872563 GGGGCCGGGTGGGGTGGGGCAGG - Intergenic
905026970 1:34857236-34857258 CCCGGGGGGTGGGGTGGGGTGGG + Intronic
905201852 1:36321374-36321396 TCCACCGGATGGTGAGGGGCGGG + Intronic
906288293 1:44602752-44602774 CAGGCCGGATGGGGTGGGGCAGG - Intronic
907437912 1:54461377-54461399 CCAGCTGGGTGGTAGGGGGCAGG - Intergenic
909897363 1:81089320-81089342 CCTGCCGGGGGTTGTGGGGGTGG - Intergenic
910825946 1:91407200-91407222 CCCGTTGGGGGGTGAGGGGCTGG + Intergenic
916218515 1:162419908-162419930 CCCTCTGGGTGGTGTGGGGCTGG + Intergenic
916970561 1:170009097-170009119 CCTGTCGGGTGGTGGGGGGAAGG + Intronic
917192960 1:172437577-172437599 CCTGCCGGGGGGTGGGGGGAGGG + Intronic
917289527 1:173457959-173457981 CCTGCCGGGGGGTGGGGGGCTGG + Intergenic
918018316 1:180659592-180659614 CCCGGCGGGGGGTGGGGGGTGGG - Intronic
918616045 1:186545445-186545467 CCTGTCGTGGGGTGTGGGGCTGG - Intergenic
919297518 1:195721501-195721523 CCCGCCCGGCGGTGTGGGGCTGG - Intergenic
920855570 1:209658513-209658535 CCCTCAGGGTGGGGTGGTGCAGG + Intergenic
921306693 1:213803954-213803976 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
923066400 1:230521322-230521344 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
923400402 1:233611197-233611219 CCCGCCGGTTGGTGTGGGGCTGG - Intergenic
924775111 1:247111147-247111169 CCCGCCGGGTGGTGTGGGGCTGG + Exonic
924792590 1:247266473-247266495 CCCACTGGGTGGTGTGGGGATGG + Intergenic
1062843905 10:690039-690061 CCCGCGGGGCGGGGCGGGGCGGG + Intergenic
1063122045 10:3112015-3112037 ACAGCCGGGCCGTGTGGGGCTGG + Intronic
1063124105 10:3124832-3124854 ACAGCGGGGTGGTGTGAGGCAGG - Intronic
1063933135 10:11049771-11049793 CACTCTGGGTGTTGTGGGGCGGG + Intronic
1064209397 10:13349803-13349825 TCTGCCGGATGGTGTGGGGGTGG + Intergenic
1065024584 10:21527454-21527476 CCGGCCGGGTCGGGTCGGGCCGG + Intergenic
1065342919 10:24723449-24723471 CCGGCCGGGTGGCCTGTGGCGGG + Intronic
1065630820 10:27679114-27679136 CCTGTCGGGAGGTGGGGGGCTGG + Intronic
1066618076 10:37316135-37316157 CCCGCCGGGTGGTGTGGGGCTGG - Intronic
1067041802 10:42958050-42958072 CCCCCTGGGTGCTCTGGGGCAGG - Intergenic
1067726528 10:48774984-48775006 TCTGCCGGGAGGGGTGGGGCTGG + Intronic
1069734013 10:70639628-70639650 CCTGCCAGGGGGTGAGGGGCTGG - Intergenic
1071225836 10:83526871-83526893 CCCACCGGGTTGTGGTGGGCAGG - Intergenic
1071554434 10:86591602-86591624 CCCGGGAGGTGGTGAGGGGCTGG + Intergenic
1071642072 10:87319404-87319426 CCTGTCGGGGGGTGGGGGGCAGG + Intergenic
1072817294 10:98521976-98521998 CCTGTCAGGGGGTGTGGGGCTGG + Intronic
1072885044 10:99265428-99265450 CCTGTCGGGTGGCTTGGGGCGGG + Intergenic
1074144133 10:110701632-110701654 CCCACTGGATGGTGTGGAGCTGG - Intronic
1075207185 10:120457624-120457646 CCGGGCAGGTGGTGCGGGGCTGG - Intronic
1075802154 10:125160389-125160411 GCCGCCGGGTGGGGTGGGAGGGG - Intronic
1076092486 10:127699813-127699835 CCAGCTGGGTGGAGTGGGGTGGG + Intergenic
1076107294 10:127833951-127833973 CCAGGCAGGTGGAGTGGGGCTGG + Intergenic
1076358430 10:129869387-129869409 CTGGCGGGGTGGTGGGGGGCGGG - Intronic
1076916411 10:133424784-133424806 CACGGCGGGTGGAGCGGGGCCGG - Intergenic
1077269133 11:1666848-1666870 CCTCCCGGGCGGTGGGGGGCCGG - Intergenic
1077271414 11:1683866-1683888 CCTCCCGGGCGGTGGGGGGCCGG + Intergenic
1078180286 11:9004700-9004722 CCCGCGGGTGGGCGTGGGGCGGG + Intergenic
1079149374 11:17884039-17884061 CCTGGCTGGTGGCGTGGGGCTGG - Intronic
1081672405 11:44949629-44949651 CCCGCTGGGCGGGGCGGGGCGGG - Intronic
1081774073 11:45665767-45665789 CCCGGCGGGTGGGTGGGGGCGGG - Intergenic
1081813482 11:45926164-45926186 CTTGCCGGGTGGGGTGTGGCAGG + Intronic
1082623345 11:55452750-55452772 CCTGCCGGATGGTGGGGGGAGGG - Intergenic
1083315946 11:61815238-61815260 CCCGCAGTGTGATTTGGGGCCGG - Intronic
1083371410 11:62185249-62185271 CCCGCCAGGTGGTGTGGGGCTGG - Intergenic
1083721937 11:64607647-64607669 CCCGCCGGCAGGTTGGGGGCCGG + Exonic
1083758341 11:64802994-64803016 CCTGCCGCGGGGTGCGGGGCTGG + Intronic
1083782246 11:64924650-64924672 CCCGCGGGGAGGTGCGGGCCGGG + Exonic
1084973108 11:72781914-72781936 CCTGCGGGGTGGGGCGGGGCGGG - Intronic
1085401729 11:76239676-76239698 CCAGCTGGGTGGTGGGGGGCAGG + Intergenic
1087868112 11:103258555-103258577 CCCGCCTGGTGCTGTGGGTTGGG + Intronic
1088831357 11:113539574-113539596 CCAGGCAGGTAGTGTGGGGCAGG - Intergenic
1089584613 11:119502500-119502522 AGCGCGGGGTGGGGTGGGGCGGG - Intergenic
1090385544 11:126355871-126355893 CCCGCGGGGCGGGGCGGGGCGGG + Intronic
1090471191 11:126982633-126982655 CACGCCTGGAGGTGTTGGGCTGG - Intronic
1090606828 11:128430535-128430557 CCTGTCGTGGGGTGTGGGGCGGG - Intergenic
1091461026 12:643332-643354 CGCGCCGGGTGGGGAGGGGAGGG + Intronic
1091498385 12:991523-991545 CCCGGGGGGTGGGGAGGGGCGGG + Intronic
1091808911 12:3378784-3378806 CCTGCCGGGTCCTGTGGGCCAGG - Intergenic
1091867826 12:3857120-3857142 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1091963607 12:4720019-4720041 TCCGCTGGGTGGTGTGGGGCTGG - Intronic
1092317326 12:7431601-7431623 CCCGTTGGGGGGTGGGGGGCTGG + Intronic
1092761280 12:11813277-11813299 CCTGGCGGGTGGGCTGGGGCTGG - Intronic
1094402243 12:30074547-30074569 CCTGTCGGGGGGTGGGGGGCAGG + Intergenic
1095520769 12:43062401-43062423 CCTGTGGGGTGGTGAGGGGCAGG - Intergenic
1095942319 12:47735331-47735353 AGCGTGGGGTGGTGTGGGGCAGG - Intronic
1097848615 12:64390349-64390371 CCCGCCGGATGGACTTGGGCGGG + Exonic
1099202210 12:79690368-79690390 CCCGCCGGCTGCTGTGGGAGCGG - Exonic
1099646799 12:85367734-85367756 TCAGCGGGGTGGTGGGGGGCGGG - Intergenic
1100130568 12:91488065-91488087 CCTGTCGGGGGGTGAGGGGCTGG + Intergenic
1100248954 12:92794724-92794746 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1100399105 12:94212473-94212495 CCTGCCGGGGGGTGGGGGGCTGG - Intronic
1101955604 12:109209370-109209392 CCATCCTGGTGGGGTGGGGCTGG - Intronic
1103244047 12:119440055-119440077 CCTGTCGGGGGGTGGGGGGCCGG + Intronic
1103775691 12:123364864-123364886 CCCGCCGGGAGGGGCGGGGGAGG + Intergenic
1103951571 12:124554376-124554398 CCAGCTGGGTGGTGGGAGGCTGG - Intronic
1104809914 12:131613897-131613919 CCCGCCGGGTCGGCTGCGGCTGG - Intergenic
1106638706 13:31559847-31559869 CCTGTCAGGGGGTGTGGGGCTGG - Intergenic
1107016949 13:35715004-35715026 CCCTCCAGCTGGTGTGTGGCTGG + Intergenic
1107247911 13:38319733-38319755 CCCGCTGGGTGGTGTGGGGCTGG - Intergenic
1107741179 13:43452269-43452291 CCCGTCAAGGGGTGTGGGGCAGG - Intronic
1108518181 13:51222269-51222291 CCCGCCGGACGGCGAGGGGCGGG + Intergenic
1109899916 13:68753917-68753939 CCTGCTGGGGGGTGCGGGGCTGG + Intergenic
1110105719 13:71673603-71673625 CCTGTTGGGGGGTGTGGGGCTGG + Intronic
1111195380 13:84869703-84869725 CCTGCTGGGTGGTATGGGGCTGG + Intergenic
1112937579 13:104820387-104820409 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1114631885 14:24164509-24164531 CCCCCTGGCTGGTGTGGGGAGGG + Intronic
1115205621 14:30900424-30900446 CTCAACGGGGGGTGTGGGGCGGG + Intronic
1115889561 14:38011587-38011609 CCTGCCGGGTGGTGTGGGGCTGG + Intronic
1116111635 14:40592372-40592394 CCTGTCGGGAGGTGGGGGGCTGG + Intergenic
1116319804 14:43447206-43447228 CCTGTCGGGTGGTGGGGGGCTGG - Intergenic
1116683801 14:48011747-48011769 CCCGCCGGGTGGTGTGGGGCTGG + Intergenic
1116689079 14:48081461-48081483 CCTGCCGGGGGGTGGGGGGAGGG + Intergenic
1118529667 14:66688907-66688929 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1118627814 14:67674880-67674902 CCCGCCGGCCGGCGAGGGGCGGG + Intronic
1119465366 14:74853764-74853786 TACGCCGGGTGGGGTGGGGTGGG - Exonic
1120216269 14:81683528-81683550 CCCGCGGGGTGGGGTGGGTGGGG + Intergenic
1121273122 14:92651158-92651180 CCAGCTGGGTGCTCTGGGGCAGG - Intronic
1122388699 14:101365727-101365749 CCTGGCGGCTGGTGTGGTGCAGG - Intergenic
1122518353 14:102324705-102324727 CCAGCCGGGTGTGGTGAGGCAGG + Intronic
1122660175 14:103289899-103289921 CCCGCAGAGTGGGGTGGGGCCGG - Intergenic
1123002943 14:105306021-105306043 CCAGGCTGGGGGTGTGGGGCAGG + Exonic
1123032053 14:105456533-105456555 CCCACCAGCTGGTGTGGGGCCGG + Intronic
1125374210 15:39011587-39011609 CCCACTGGGTGGTGTGGGGCTGG + Intergenic
1125722098 15:41850089-41850111 CCCACGTGGGGGTGTGGGGCGGG + Intronic
1126109325 15:45166671-45166693 CCCGCGGGGTGGGGCGGGCCTGG + Intergenic
1126119939 15:45242498-45242520 CCCGCTGGGTGATGTGGGGCTGG - Intergenic
1126177644 15:45752656-45752678 CCTGTTGGGGGGTGTGGGGCTGG - Intergenic
1126668356 15:51094500-51094522 CCAGGCGGGTGGGCTGGGGCTGG - Intronic
1126943462 15:53791622-53791644 CCTGCCGGGTGGTGTGGGGCTGG - Intergenic
1127008276 15:54594810-54594832 CCCACTGGGTGGTGTGGGGCTGG - Intronic
1127071066 15:55289302-55289324 CCCTCCGGTTGGTGAGGGTCTGG - Intronic
1127256622 15:57298840-57298862 CCCCCGCGTTGGTGTGGGGCCGG + Intronic
1128784444 15:70384425-70384447 CCCGCATGGAGGTGTGGGGCCGG - Intergenic
1130548531 15:84874060-84874082 CCCGTCAGGGGGTGGGGGGCTGG - Intergenic
1130913819 15:88289645-88289667 CTTGCCAGCTGGTGTGGGGCAGG - Intergenic
1132607882 16:801004-801026 CCAGCCGGGAGGAGTGGGGATGG + Intergenic
1132612693 16:825146-825168 CCCGCCGGTTGGTAAGAGGCAGG - Intergenic
1132991722 16:2798909-2798931 GCTGCCGGGTGGGGTGGGGTGGG - Intergenic
1133640596 16:7713428-7713450 CCCGCCCGGGGATGTGGGGTGGG + Intergenic
1135075930 16:19393593-19393615 CCCACTGGGTGGTGTGGGGCTGG - Intergenic
1135076883 16:19401577-19401599 CCCACTGGGTGGTGTGGGGCTGG - Intergenic
1138179757 16:54933280-54933302 CCGGCGGGGTAGTGAGGGGCCGG - Exonic
1138795030 16:59957596-59957618 CCTGTCGGGGGGTGAGGGGCTGG - Intergenic
1139420003 16:66844329-66844351 CCTGCTGGGGGGTGGGGGGCGGG + Intronic
1139546924 16:67653765-67653787 CAGGCCGGGTGGAGTGGGGGTGG + Intronic
1140129557 16:72148363-72148385 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1142194888 16:88734798-88734820 CCTGCCGGGTGAGGTGGGGGTGG + Exonic
1142961866 17:3556539-3556561 CCAGCTGGGTGGGGTGGAGCTGG + Intronic
1145039588 17:19567427-19567449 CCCGCAGGGGTGTGAGGGGCAGG - Intronic
1147428155 17:40356112-40356134 ACAGCCGGGGGGTGGGGGGCGGG + Exonic
1148559155 17:48596237-48596259 CCCGCCGGGAGCTGTGCGGGCGG + Exonic
1148842555 17:50508364-50508386 CCAGCCGGGCGGGGCGGGGCGGG - Exonic
1149105733 17:52962038-52962060 CCCGCTGGGTGGTGTGGGGCTGG + Intergenic
1149315915 17:55438527-55438549 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1149638271 17:58187010-58187032 CCAGGTGGGTGGGGTGGGGCAGG - Intergenic
1151578100 17:74962931-74962953 TCCGCCTGGGGGTGGGGGGCTGG + Intronic
1152077496 17:78168539-78168561 CCCGGCGGGTGGAGTCGGGCGGG + Exonic
1152121158 17:78419483-78419505 CCGGCCATGTGGTGTGGTGCTGG + Intronic
1152209156 17:78993969-78993991 ACGGCCTGATGGTGTGGGGCTGG - Intronic
1152697671 17:81804832-81804854 TCGGCCGGGTGGTGGGGCGCCGG - Intronic
1152758949 17:82098425-82098447 CGCGCCTGGGGGGGTGGGGCTGG + Intergenic
1153388463 18:4527630-4527652 CCCGCTGGGTAGTGTGGGGCTGG - Intergenic
1154231403 18:12559169-12559191 CCCACGGGGTGGGGTGGGGTGGG + Intronic
1154940924 18:21111886-21111908 TCCGCAGGGTGGGGTGGGGCGGG + Intergenic
1155218328 18:23662634-23662656 CCCGCGGGGTCGGGTGGGGTGGG - Intronic
1155932406 18:31721179-31721201 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1156257051 18:35408816-35408838 CCTGCTGTGTGCTGTGGGGCTGG + Intergenic
1156465626 18:37346545-37346567 CACGCCAGGAGGTGGGGGGCAGG + Intronic
1158324490 18:56299499-56299521 CACGCTGGGTGGAGTTGGGCAGG - Intergenic
1159737886 18:72124864-72124886 CCTGCCGGGCGGTGGGGGGTTGG + Intergenic
1160190562 18:76711164-76711186 CTAGCTGGGTGGGGTGGGGCAGG + Intergenic
1160600934 18:80012114-80012136 CCCACCGGGTAGTGTGGGGCTGG + Intronic
1160842816 19:1154148-1154170 CCCGTCGGGTGGGCCGGGGCCGG + Intronic
1160858535 19:1227936-1227958 CCCGCCAGCTGGTCTGCGGCGGG - Exonic
1160877025 19:1301273-1301295 CACGCCCGGTGGTGGGGGGTGGG + Intergenic
1161102825 19:2429687-2429709 TCCCCGGGGTGGCGTGGGGCTGG - Exonic
1161238014 19:3207506-3207528 CCCGCCGGGAGGAGCTGGGCTGG + Intronic
1161301094 19:3543613-3543635 CCCACCGGGTGCTGGGGGCCTGG - Exonic
1161357063 19:3825104-3825126 CCCGGGGGGTGGTGAGGGGCTGG - Intronic
1161722148 19:5909036-5909058 CCCACCGGGGGGTGGGTGGCCGG - Exonic
1161998874 19:7730924-7730946 TGCGGCGGGTGGTGCGGGGCGGG - Intronic
1162145598 19:8610915-8610937 CCCGCCGCGTGGGAGGGGGCTGG + Intergenic
1162345673 19:10116788-10116810 GCTGCCGGGAGGTGTGGGGGTGG - Exonic
1162426870 19:10602414-10602436 CCCGGCGGGAGGGGCGGGGCCGG + Intergenic
1162659215 19:12156383-12156405 GCCGCAGGGTGGGGTTGGGCCGG - Intronic
1162728881 19:12705944-12705966 CCCGGGGGGTGGGGTGGGGCGGG - Intronic
1163157569 19:15447874-15447896 CCCACTGGGTGGTATGGAGCTGG - Intronic
1163380838 19:16967332-16967354 CCTGTCGGGGGGTGGGGGGCCGG + Intronic
1163566003 19:18051872-18051894 CCCGCCGGGCGGGCTGGGGGTGG - Intergenic
1163733180 19:18961930-18961952 TGCGCCGGGTGGGCTGGGGCTGG + Intergenic
1163756845 19:19111392-19111414 CCGGCAGGGTGGGGTGGGCCAGG - Exonic
1164692568 19:30222349-30222371 CACCCCTGGTGGGGTGGGGCTGG + Intergenic
1165861570 19:38911947-38911969 CCCGCCGGGTGGGATGGGGAGGG - Intronic
1165992783 19:39825839-39825861 GCAGCCGGGTGCTGGGGGGCAGG + Exonic
1166161198 19:40954720-40954742 CCTGCAGGGTGGTGTGGGGCTGG + Intergenic
1166393783 19:42424426-42424448 CCGCCGCGGTGGTGTGGGGCGGG + Intronic
1166694476 19:44844883-44844905 CCGGCCGGGCTGGGTGGGGCTGG - Intergenic
1166716703 19:44973130-44973152 CCCGCCTGGTCCTGAGGGGCCGG - Exonic
1167288029 19:48609840-48609862 GACGCCGGGAGGTGGGGGGCGGG + Intronic
1167569298 19:50276894-50276916 CCCGGAGGGTGGGTTGGGGCAGG + Exonic
1167862032 19:52292963-52292985 CCTGTCGGGGGGTGGGGGGCTGG - Exonic
1168594494 19:57664440-57664462 CGCCCCGGGTGCTGCGGGGCGGG - Intergenic
1168617534 19:57850603-57850625 TCTGCTGGGTGGTGTGGGGCTGG - Intronic
1168713340 19:58513841-58513863 CCCTCCAGGTGGTGCCGGGCTGG - Exonic
926851653 2:17204734-17204756 CCTGTCGGGGGGTGGGGGGCAGG - Intergenic
928511962 2:32010673-32010695 CCCCGCGGGGGGTGGGGGGCGGG - Intronic
928776345 2:34768416-34768438 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
929539944 2:42811411-42811433 CCCCCCTGGCGATGTGGGGCAGG - Intergenic
930744159 2:54863542-54863564 CCTGGTGGGTGGTGTGGGGAAGG + Intronic
932265733 2:70365633-70365655 CCCTCCAGGTGGTGAGAGGCAGG - Intergenic
932279086 2:70473905-70473927 TCAGCTGGGTGGGGTGGGGCAGG + Intronic
932416490 2:71576551-71576573 GCCGCAGGGCGGGGTGGGGCGGG + Intronic
932830962 2:74989424-74989446 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
933066817 2:77808152-77808174 CCCACTGGGTGGTGTGGGGGAGG + Intergenic
933362348 2:81304442-81304464 CCAGCTGGGTGGTGTGGGGCTGG - Intergenic
933419860 2:82031246-82031268 CCCACTGGGTGGAGTGGAGCTGG + Intergenic
934870501 2:97860927-97860949 GCTGCCGGGTGGAGTGGGGTAGG - Intronic
934879746 2:97965474-97965496 CCCGCCAGGTGGTGTGGGGCTGG + Intronic
935237415 2:101150811-101150833 AACGCCGGGTGGAGCGGGGCCGG - Intronic
935251545 2:101266253-101266275 CCACCTGGGTGGGGTGGGGCAGG + Intronic
935399142 2:102641891-102641913 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
937239098 2:120449007-120449029 CCAGCCTGGTGCTGTGGGCCGGG + Intergenic
937572880 2:123385445-123385467 CCTGTCGTGTGGTGTGGGGAGGG + Intergenic
937715148 2:125024220-125024242 CCCACTGGGTGGTGTGGGGCTGG - Intergenic
938874944 2:135522437-135522459 CCCGCCGGGTGGTGTGGGGCTGG + Intronic
939185906 2:138860929-138860951 CCCACTGGGTGGCGTGGGGCTGG - Intergenic
939377309 2:141385052-141385074 CCCGCTGGGTGGTGTGGGGCTGG + Intronic
939990699 2:148875322-148875344 CCCGCCGCGTGGTCGCGGGCAGG + Exonic
940839421 2:158561926-158561948 CCTGTCGGGGGGTGGGGGGCTGG - Intronic
940978225 2:159970945-159970967 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
941541030 2:166784654-166784676 CCCTCTGGGGGGTGGGGGGCGGG - Intergenic
941773984 2:169371921-169371943 CCTGGTGGGTGGTGGGGGGCAGG + Intergenic
941972395 2:171365584-171365606 CCCGCCAGGTGGTATGGGGCTGG + Intronic
942830997 2:180237404-180237426 CCCGCTGGGTGGTGTGGGGCTGG + Intergenic
943833215 2:192487914-192487936 CCCGCTGGGTGGTGTGGGGCTGG + Intergenic
943960434 2:194256171-194256193 CCGGCCGGGTGGTGTGAGGCTGG - Intergenic
945006773 2:205417077-205417099 CCTGCCGGGGGGTGGGGGGAGGG - Intronic
945891585 2:215436169-215436191 GCGGGCGGGTGGGGTGGGGCGGG - Exonic
946375974 2:219309178-219309200 GCTGGCGGGTGGTGGGGGGCGGG - Intronic
947353579 2:229271092-229271114 CGCGCCGGGGGGCGAGGGGCTGG + Exonic
947741818 2:232488124-232488146 CCAGCCGGCTGGTGGGCGGCTGG - Intergenic
948209155 2:236179535-236179557 GCCGCCGGGAGGGGTGGGGCGGG - Intergenic
948493587 2:238330533-238330555 CCGGCCGGGCAGTGAGGGGCAGG + Intronic
948958852 2:241316098-241316120 CCGGCGGGGCGGTGTGGGGGAGG + Intronic
1169227201 20:3864265-3864287 CCCACGGGATGGTGTGAGGCTGG - Exonic
1169862282 20:10165385-10165407 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1170400529 20:15978346-15978368 CCCTCCGGGTGGCATGGGGGAGG + Intronic
1170552438 20:17489373-17489395 CCCAGCGGGTGGTATGGCGCTGG + Intergenic
1170568139 20:17618070-17618092 CCCGGCAGCTGGTATGGGGCCGG + Intronic
1172118426 20:32584516-32584538 CCCGCCGCGGGGCTTGGGGCAGG - Intronic
1173579502 20:44137243-44137265 GCTCCCGGGTGGGGTGGGGCGGG - Intronic
1175108703 20:56631085-56631107 CCCGCCGGGCGGGGTGCGGTTGG + Intronic
1175246721 20:57586466-57586488 GCCACTGGGTGGTGTGGGGGAGG + Intergenic
1175804280 20:61818840-61818862 ACTGCCGGGTGGGGTGGCGCAGG - Intronic
1175895628 20:62334485-62334507 CCCACTGGGTGGTGGGGAGCGGG - Intronic
1176132131 20:63500627-63500649 CCAGCTGGGTGGGGTGGGGCGGG - Intergenic
1176222086 20:63974566-63974588 CTCTCTGGGTGGTTTGGGGCTGG - Exonic
1176379804 21:6106565-6106587 CCCGGCGGGGGGCATGGGGCAGG - Intergenic
1177672980 21:24257323-24257345 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1178533822 21:33396553-33396575 CCAGGCGGGGGGTGGGGGGCGGG - Intergenic
1178892492 21:36531640-36531662 CCCTCCTGGTGGAATGGGGCAGG + Intronic
1179743670 21:43431672-43431694 CCCGGCGGGGGGCATGGGGCAGG + Intergenic
1179910498 21:44444856-44444878 CCCGCCGGGTGTGGTGGAGTGGG + Intergenic
1179937530 21:44614611-44614633 CCTGCCTGGGGGTGTTGGGCTGG + Intronic
1180068227 21:45423491-45423513 CCCTCCGGGGGGCGGGGGGCGGG - Intronic
1180091768 21:45537161-45537183 CCTGGCGGGTGGGGTGGGGCAGG + Intronic
1180193523 21:46180797-46180819 CCCGCCACAGGGTGTGGGGCAGG - Intronic
1182519885 22:30879201-30879223 CCCTCCGGGGCCTGTGGGGCAGG + Intronic
1183417475 22:37690855-37690877 CCCTTAGGGTGGTGTGGAGCAGG + Intronic
1183524409 22:38315115-38315137 TCTGCAGGGTGGTGTGGGACAGG - Intronic
1183688229 22:39374254-39374276 TCCCCTGGGTGGTGTGAGGCAGG + Intronic
1183722240 22:39569166-39569188 CCCGCCTGGGGGTCTGGTGCTGG + Intergenic
1184114294 22:42413267-42413289 CCCTGCCTGTGGTGTGGGGCTGG + Intronic
1184504642 22:44893422-44893444 CCCTCCTGGTGGCATGGGGCTGG + Intronic
1185197487 22:49481445-49481467 ACCTCGGGGTGATGTGGGGCTGG + Intronic
1185220323 22:49626384-49626406 CCCCCAGGGTGGGGTGGGGTTGG - Intronic
1185368311 22:50446974-50446996 CCGGCCGGGCGGGGCGGGGCGGG + Exonic
1185370564 22:50459095-50459117 CCCTCCGGGTGCCGTGGGGCAGG - Intronic
949945551 3:9187110-9187132 CCTGTCGGGGGGTGGGGGGCTGG - Intronic
950940137 3:16884239-16884261 GCCGGCGGGTGGGGTGGGTCTGG + Intronic
954709506 3:52498357-52498379 CCAGCTGGGTGGAGTGAGGCTGG - Intronic
955265957 3:57444897-57444919 CCAGGGGGGTGGGGTGGGGCAGG - Intronic
955410922 3:58654767-58654789 CCCGCCGGGTCCTGTGGGGTGGG + Intronic
955412857 3:58667142-58667164 GGCGCTGGGAGGTGTGGGGCTGG + Intergenic
955489637 3:59469503-59469525 CCCACCACGTGGTGTGGGGCTGG - Intergenic
955642421 3:61100208-61100230 CCTGTCGGGGGGTGTGGGGCTGG - Intronic
955770317 3:62378607-62378629 GCCGCCGGGTGCAGTGGGCCGGG - Intergenic
957521988 3:81329914-81329936 CCTGCTGGGTGGTGTGGGGCTGG - Intergenic
957694544 3:83618421-83618443 CCCGCTGGGTGGTGTGGGGCTGG - Intergenic
958087348 3:88827382-88827404 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
958433763 3:94072951-94072973 CCTGTCGGGTGGTGAGGGGCTGG - Intronic
960456043 3:117873449-117873471 GCAGCAGGGTGGTGTGGAGCTGG - Intergenic
960950897 3:122997837-122997859 CACTCTGGGTGGTGTGGGGCAGG - Intronic
962266892 3:133950271-133950293 CCAGCCGGGGGGAGAGGGGCAGG - Intronic
962275658 3:134011603-134011625 CCCGCAGGGTGGTATGTGGCAGG - Intronic
964269853 3:154944342-154944364 CCCACTGGGTGGTGTGGGACTGG - Intergenic
965024483 3:163283201-163283223 CCCGCTGGTTGGTGTGGGGCTGG - Intergenic
965409097 3:168307202-168307224 CCTGTCGGGGAGTGTGGGGCTGG - Intergenic
965469910 3:169078105-169078127 CCCACCTGAAGGTGTGGGGCAGG - Intergenic
966182147 3:177197347-177197369 CCCGCCGCGGGGGGAGGGGCGGG + Intronic
966860018 3:184226058-184226080 CCAGCCAGTTGGTGTGGGGGGGG - Intronic
968739233 4:2319057-2319079 CCTCCTGGGCGGTGTGGGGCTGG - Intronic
970180887 4:13391898-13391920 CCTGTCGGGAGGTGGGGGGCTGG + Intronic
970407643 4:15778765-15778787 CCCGCCGGGTGGTGCTGAGTAGG + Intronic
970766606 4:19556651-19556673 CCCGCTGGGTGGTGTGGGGCTGG + Intergenic
970918009 4:21358162-21358184 CCTGTCAGGTGGTGGGGGGCTGG + Intronic
972686801 4:41360413-41360435 CCCGCCGGCTGCTGAGGGGCGGG - Intronic
975118708 4:70705625-70705647 CGCCCCGGGTGGAGGGGGGCAGG - Intronic
975342434 4:73257958-73257980 CACGCCGGGGGGTGGGGGGGTGG - Intronic
976306537 4:83565680-83565702 CCCACCGGGTGGTGTGGGGCTGG - Intronic
976348287 4:84030459-84030481 CCTGTCGGGGGGTGGGGGGCGGG + Intergenic
979016921 4:115446783-115446805 CCTGTCAGGTGGTGGGGGGCTGG - Intergenic
979126614 4:116980774-116980796 CCCGCTGGGTGGTGTGGGGCTGG + Intergenic
979660106 4:123243590-123243612 CCTGTCAGGTGGTGGGGGGCTGG + Intronic
980153925 4:129081421-129081443 CCTGCCAGGTGGTGTGGGGCTGG + Intronic
982584779 4:157222457-157222479 CCGGCCGGGTGGCGTGGGGGTGG + Intronic
983327438 4:166274592-166274614 CCCGCTGGGTGGTGTGGGGCTGG + Intergenic
983661345 4:170133310-170133332 CCCACTGGGTGGTGTGGGGCTGG - Intergenic
984494119 4:180472977-180472999 CCTGTCGGGTGGTGGGGGCCTGG + Intergenic
986917523 5:12640262-12640284 CCTGTCGGGAGGTGGGGGGCTGG + Intergenic
987902943 5:24037372-24037394 CCTGTCGGGGGGTGGGGGGCTGG - Intronic
988608183 5:32700544-32700566 CCTGTCGGGGGGTGGGGGGCTGG - Intronic
988688158 5:33545854-33545876 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
989344133 5:40410257-40410279 CTTGGCGGATGGTGTGGGGCAGG - Intergenic
990536114 5:56724412-56724434 CCTGTCGGGCGGTGGGGGGCTGG - Intergenic
992195006 5:74330525-74330547 CCCTTGGGGTGGCGTGGGGCAGG - Intergenic
992343605 5:75852157-75852179 CCTGTCAGGTGGTGGGGGGCTGG + Intergenic
992344244 5:75860076-75860098 CCCACCAGGTGGTGTGGGGCTGG + Intergenic
992409701 5:76493274-76493296 CCAGAGGGGTGGTGAGGGGCGGG - Intronic
994009617 5:94885594-94885616 CCAGCGGGGTGGGGTGGGGTGGG - Intronic
994241267 5:97424350-97424372 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
994917453 5:105998974-105998996 CCCGCTGGGTGGTGTGGGGCTGG - Intergenic
996763994 5:127017107-127017129 CCTGTCAGGTGGTGGGGGGCTGG + Intronic
997963412 5:138338833-138338855 CTCCCCAGGAGGTGTGGGGCTGG + Intronic
998374586 5:141682276-141682298 CCGGCCGGGCGGGGCGGGGCTGG - Intergenic
998507833 5:142686299-142686321 CCCTGCGGGTGGTGTGGGAGTGG - Intronic
1001912852 5:175535281-175535303 CCAGTCAGGGGGTGTGGGGCTGG - Intergenic
1002790242 6:432159-432181 CCCGCAGGGTGGTGCGGTGGGGG + Intergenic
1002973619 6:2050951-2050973 CCTGTCAGGGGGTGTGGGGCTGG + Intronic
1003445917 6:6184329-6184351 CCCGCAGGGTGGTGTGGGAAAGG - Intronic
1004503173 6:16227024-16227046 CCCGCAGGGCGGGGCGGGGCGGG - Intergenic
1005584391 6:27261343-27261365 CCCGCGGGGGGGAGTGGGGGGGG + Intergenic
1006813337 6:36835048-36835070 CCCACCAGCTGGTATGGGGCTGG - Intronic
1006827658 6:36948080-36948102 CCGGCTGGGTGGCCTGGGGCAGG - Intergenic
1008222598 6:48874224-48874246 CCCACCGGGTGGTGTGGGGCTGG + Intergenic
1008223309 6:48879692-48879714 CCTGCCGGGAGGTGTGGGGCTGG + Intergenic
1008865986 6:56210099-56210121 CCTGTTGGGTGGTGGGGGGCTGG + Intronic
1010316088 6:74452222-74452244 ACCCCCGGATGCTGTGGGGCTGG + Intergenic
1010755135 6:79658290-79658312 CCTGTCGGGTGGTGGGGGCCTGG - Intronic
1010974609 6:82297923-82297945 CCCGCTGGGTGGTGTGGGGCTGG - Intergenic
1011272523 6:85593876-85593898 CGCGGCGGGGGGCGTGGGGCTGG - Exonic
1011643038 6:89433113-89433135 GCCGCCGGCAGGGGTGGGGCGGG + Intergenic
1011725782 6:90209046-90209068 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1013619381 6:111873155-111873177 GCCGCCGGGCGGTGCGGCGCGGG + Exonic
1015133567 6:129841414-129841436 CCGGTCGGGGGGTGGGGGGCTGG + Intronic
1017941368 6:159056053-159056075 CCCTCCTGATGCTGTGGGGCTGG - Intergenic
1018717016 6:166541249-166541271 ACCGCCCAGAGGTGTGGGGCAGG + Intronic
1018876538 6:167826905-167826927 CCCGCCGGCCGGTGTGCGCCCGG - Intronic
1019010880 6:168842610-168842632 CCTGCCGTGATGTGTGGGGCTGG + Intergenic
1019038729 6:169084775-169084797 CCCGCCGGGTGATGTGGGGCTGG + Intergenic
1020553657 7:9641150-9641172 CCTGTCGGGGGGTGAGGGGCTGG - Intergenic
1020939223 7:14509794-14509816 CCTGCTGGGTGGTGTGGGGCTGG + Intronic
1022474314 7:30700096-30700118 AGGGCCGGGTGGGGTGGGGCTGG - Exonic
1023985008 7:45089101-45089123 ACAGCCGGGTGGGGTGGGGGCGG - Intergenic
1024041160 7:45556355-45556377 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
1024105829 7:46085529-46085551 CCTGTCGGGGGGTGGGGGGCCGG - Intergenic
1024330143 7:48147265-48147287 CCCACCGGGTGGTGTGGGGCTGG - Intergenic
1024335299 7:48200932-48200954 CCTGCCAGGTGGTGTGGGGCTGG - Intronic
1026454387 7:70558001-70558023 CCAGCCAGGTGGAGTGGGGATGG + Intronic
1026794662 7:73358934-73358956 GCCTCAGGGTCGTGTGGGGCAGG - Intergenic
1028192267 7:87867042-87867064 CCCACTGGGTGGTGTGCGGCTGG + Intronic
1028280947 7:88926924-88926946 TCTGCCGGGTGGTGGGGAGCGGG + Intronic
1029646110 7:101857082-101857104 CGCGGCGGGTGGTACGGGGCAGG - Intronic
1029730097 7:102433405-102433427 CCCGCCGGGCCGGGAGGGGCGGG - Intronic
1033197585 7:139341030-139341052 CCCGGCGGGGGGTGTGGGTGTGG - Intronic
1033281551 7:140009789-140009811 CCAGCATGGAGGTGTGGGGCAGG - Intronic
1033669110 7:143472711-143472733 CCCGCTGGGTAGTGTGGGGCTGG + Intergenic
1034100325 7:148445306-148445328 CCCACAGGGTGGGGTGGGGTGGG + Intergenic
1034673492 7:152874512-152874534 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
1034722581 7:153308175-153308197 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1034839129 7:154379351-154379373 CCTGTCAGGTGGTGGGGGGCTGG + Intronic
1035212730 7:157340290-157340312 CCCACCTGGTGGTGAGAGGCGGG + Intronic
1035621111 8:1036368-1036390 CCCGACGTGTGGTGTGAGGTGGG + Intergenic
1035904216 8:3491830-3491852 CCCGCCGGGTGGTGTGGGGCTGG - Intronic
1035988781 8:4464761-4464783 CCTGCTGAGTGGGGTGGGGCTGG + Intronic
1037810023 8:22081519-22081541 CCCGGCGGGTTGGGAGGGGCAGG + Exonic
1037824281 8:22151734-22151756 GCCGCTGGGTGTTGTGGGGCAGG + Intronic
1039474162 8:37830617-37830639 CCAGCAGGATGGGGTGGGGCGGG - Intronic
1039832907 8:41230947-41230969 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1039948789 8:42152419-42152441 CCAGCCGGGGAGTGAGGGGCTGG - Intergenic
1040059420 8:43091944-43091966 CCCGCCGGGTGGTGTGGGGCTGG - Intergenic
1040122004 8:43694028-43694050 CCCGCCAAGTGGTGTGGGGATGG - Intergenic
1040122895 8:43702007-43702029 CTCACCGGGTGGTGTGGGGGTGG - Intergenic
1040138428 8:43882501-43882523 CCCACGGGGTGGTGTGGAGCTGG - Intergenic
1040787065 8:51178604-51178626 CCCTCTGGGTGGTGTGGGGCTGG - Intergenic
1041200474 8:55449336-55449358 CTGGCCGGGCGGTGCGGGGCAGG + Intronic
1041915767 8:63137222-63137244 CCTGTCAGGTGGTGCGGGGCTGG + Intergenic
1042271848 8:66962733-66962755 GCCGCCGGCTGCGGTGGGGCCGG + Intergenic
1042812174 8:72838262-72838284 CCTGTCGGCTGGTGGGGGGCTGG - Intronic
1043295341 8:78654643-78654665 CACACTGGGTGGTGTGGGGCTGG + Intergenic
1044609837 8:94080564-94080586 CCCGCCGGCCGGTGAGTGGCAGG - Intergenic
1044767120 8:95588175-95588197 CCTGTTGGGGGGTGTGGGGCTGG - Intergenic
1046031470 8:108787615-108787637 CACGGCGGGCGGGGTGGGGCGGG + Exonic
1046759852 8:118009802-118009824 CCAGGAGGGTGGTGTGGGGATGG - Intronic
1049047017 8:140160638-140160660 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1049358665 8:142201381-142201403 CTCGCCGGGAGATGTGGGCCCGG - Intergenic
1049373682 8:142279313-142279335 CCCGCCTGGTGTCGTGTGGCCGG - Intronic
1049413439 8:142484137-142484159 CCCGCCGGGTGCTCTGGGTTTGG + Intronic
1049552603 8:143267415-143267437 CCGGCCGGGCGGAGTGGGGCGGG + Exonic
1049654409 8:143791478-143791500 CCACCTGGGTGGTTTGGGGCAGG - Intronic
1049741142 8:144241585-144241607 CCTGCGGGCTGGAGTGGGGCAGG + Intronic
1049877252 8:145032686-145032708 CCCACTGGGTGTTGTGGGGCTGG + Intergenic
1051406527 9:16743592-16743614 CCCTGCGGGTGCTTTGGGGCTGG - Intronic
1054890541 9:70246309-70246331 CCTGCCAGGGGGTGGGGGGCTGG + Intergenic
1057047931 9:91900207-91900229 GCCGCCAGGGGGTGGGGGGCAGG + Intronic
1057802881 9:98200552-98200574 CCGGCGGGGTGGTGGGGGGGCGG + Intronic
1058412378 9:104747883-104747905 CCCGACGGGAGGGGAGGGGCGGG + Intronic
1059466299 9:114470814-114470836 GCCCCGGGGTGGGGTGGGGCGGG - Intronic
1059545213 9:115169048-115169070 CCCTCAGGGTGGGGTGGGGTGGG - Intronic
1061880533 9:133566708-133566730 CCAGCTGGGTTGGGTGGGGCGGG + Intronic
1062365208 9:136205090-136205112 CCCGCCGCGTCGTGCGGGGCAGG + Intronic
1062461869 9:136665710-136665732 GCCGCCAGGTGGGGCGGGGCCGG + Intronic
1062595411 9:137296930-137296952 CCTGGCGGGGGATGTGGGGCAGG + Intergenic
1062653685 9:137591000-137591022 CCCTCCGGGTCGCGTGGGCCGGG - Intergenic
1185469431 X:373778-373800 CCCGCCAGGCGCTCTGGGGCCGG + Intronic
1185479587 X:435892-435914 ACCGCAGGATGGTGTGAGGCCGG + Intergenic
1185610649 X:1392212-1392234 CACGCAGGCTGGTGTGGGGCGGG - Exonic
1185926818 X:4156233-4156255 CCTGTTGGGTGGTGGGGGGCTGG + Intergenic
1186600746 X:11034298-11034320 CCCCCTGGGTGGTGTGGGGCTGG + Intergenic
1186658201 X:11639360-11639382 CATGTCGGGTGGTGGGGGGCTGG - Intronic
1186802383 X:13106127-13106149 TTCGCAGGGTGGTGGGGGGCGGG - Intergenic
1187067578 X:15855177-15855199 CCTAGCGGGTGGTGCGGGGCAGG + Intergenic
1187686026 X:21816417-21816439 GCTGGCGGGTGGTGTGGGGTGGG - Intergenic
1188950712 X:36370248-36370270 CCTGCTGGGGGGTGGGGGGCTGG - Intronic
1189162628 X:38826076-38826098 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
1189321969 X:40092249-40092271 CGCGCCGGGCGGAGTGGGGCAGG - Intronic
1189844733 X:45124238-45124260 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1190998106 X:55631601-55631623 CCTGTCGGGGGGTGTGGGGCTGG + Intergenic
1192632122 X:72785270-72785292 TCCACAGGGTGGTGCGGGGCGGG - Intronic
1192649587 X:72935531-72935553 TCCACAGGGTGGTGCGGGGCGGG + Intronic
1193414086 X:81200700-81200722 CCAGTCGGGGGGTGGGGGGCTGG + Intronic
1194387375 X:93273195-93273217 CCCGCCGGGTGGTGTGGGGTTGG - Intergenic
1194544432 X:95215048-95215070 CCTGTCGTGTGGTGTGGGGAGGG + Intergenic
1195988883 X:110662881-110662903 CCTGTCAGGTGGTGGGGGGCTGG + Intergenic
1196113780 X:111975574-111975596 TCTGTCGGGGGGTGTGGGGCTGG - Intronic
1198161792 X:134015511-134015533 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
1199011830 X:142767878-142767900 CCTGTTGGGTGGTGTGGGGCTGG - Intergenic
1199176268 X:144791270-144791292 CCAGCTGGGTGGTGTAGGGCTGG - Intergenic
1199607271 X:149586705-149586727 CCCGCGGGGTGGTCCAGGGCTGG + Intronic
1199631852 X:149782662-149782684 CCCGCGGGGTGGTCCAGGGCTGG - Intronic
1199772537 X:150983855-150983877 CCCGCCGGGGGCTGCGCGGCTGG + Intronic
1200267242 X:154653074-154653096 GGCGCCGGGTGGGGTGGGGGTGG - Intronic
1200862364 Y:8006630-8006652 CCTGCTGGGTGGTGTGGGGCTGG - Intergenic
1200873326 Y:8126195-8126217 CCTGCCGGGTGGTGTAGGGCTGG - Intergenic
1200873448 Y:8127327-8127349 CCTGCCAGGTGGTGTGGGGCTGG + Intergenic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1201062085 Y:10055203-10055225 CCTGCTGGGTGGTGTGGGACTGG + Intergenic
1201765844 Y:17572992-17573014 CCTGCTGGCTGGTGTAGGGCTGG - Intergenic
1201776461 Y:17671225-17671247 CCCACTGGGTAGTGCGGGGCTGG - Intergenic
1201783221 Y:17745371-17745393 CCCACTGGGTGGTGTGGGACTGG + Intergenic
1201818332 Y:18160616-18160638 CCCACTGGGTGGTGTGGGACTGG - Intergenic
1201825095 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG + Intergenic
1201835708 Y:18332997-18333019 CCTGCTGGCTGGTGTAGGGCTGG + Intergenic
1201862329 Y:18612705-18612727 CCTGCTGGGTGGTGTGGGGGTGG - Intergenic
1201863222 Y:18622537-18622559 CGTGCTAGGTGGTGTGGGGCTGG - Intergenic
1201863662 Y:18626375-18626397 CCCACTGGGTGGTGAGGGGATGG - Intergenic
1201867673 Y:18672341-18672363 GCCTCCGGGTGAGGTGGGGCTGG + Intergenic
1201869660 Y:18694003-18694025 CCCACTGGGTGGTGAGGGGATGG + Intergenic
1201870100 Y:18697841-18697863 CGTGCTAGGTGGTGTGGGGCTGG + Intergenic
1201870994 Y:18707675-18707697 CCTGCTGGGTGGTGTGGGGGTGG + Intergenic
1202113224 Y:21446243-21446265 CCTGCCAGGCAGTGTGGGGCTGG - Intergenic
1202113901 Y:21451781-21451803 ACCGCCAGCTGGTGTGGGGCTGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic
1202342974 Y:23888783-23888805 CCCATCAGGTGATGTGGGGCTGG + Intergenic
1202527794 Y:25781302-25781324 CCCATCAGGTGATGTGGGGCTGG - Intergenic