ID: 1116683804

View in Genome Browser
Species Human (GRCh38)
Location 14:48011771-48011793
Sequence TTCCCCACCAAGTTACTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116683789_1116683804 27 Left 1116683789 14:48011721-48011743 CCTTTGTCTCCGCCGGACTCGGG No data
Right 1116683804 14:48011771-48011793 TTCCCCACCAAGTTACTTTTAGG No data
1116683792_1116683804 18 Left 1116683792 14:48011730-48011752 CCGCCGGACTCGGGGTACCCGCC No data
Right 1116683804 14:48011771-48011793 TTCCCCACCAAGTTACTTTTAGG No data
1116683803_1116683804 -3 Left 1116683803 14:48011751-48011773 CCGGGTGGTGTGGGGCTGGTTTC 0: 16
1: 13
2: 10
3: 20
4: 196
Right 1116683804 14:48011771-48011793 TTCCCCACCAAGTTACTTTTAGG No data
1116683800_1116683804 1 Left 1116683800 14:48011747-48011769 CCCGCCGGGTGGTGTGGGGCTGG No data
Right 1116683804 14:48011771-48011793 TTCCCCACCAAGTTACTTTTAGG No data
1116683802_1116683804 0 Left 1116683802 14:48011748-48011770 CCGCCGGGTGGTGTGGGGCTGGT No data
Right 1116683804 14:48011771-48011793 TTCCCCACCAAGTTACTTTTAGG No data
1116683794_1116683804 15 Left 1116683794 14:48011733-48011755 CCGGACTCGGGGTACCCGCCGGG No data
Right 1116683804 14:48011771-48011793 TTCCCCACCAAGTTACTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116683804 Original CRISPR TTCCCCACCAAGTTACTTTT AGG Intergenic
No off target data available for this crispr