ID: 1116684662

View in Genome Browser
Species Human (GRCh38)
Location 14:48022694-48022716
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116684659_1116684662 28 Left 1116684659 14:48022643-48022665 CCAATGTTAATATTTTTGTTTAT No data
Right 1116684662 14:48022694-48022716 GTGGAGTGGTATTCTGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116684662 Original CRISPR GTGGAGTGGTATTCTGTTCT TGG Intergenic