ID: 1116685776

View in Genome Browser
Species Human (GRCh38)
Location 14:48036264-48036286
Sequence CTGGGGGTGTGGCTCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116685766_1116685776 15 Left 1116685766 14:48036226-48036248 CCAGACTGGGTAGTATGTTCAGT No data
Right 1116685776 14:48036264-48036286 CTGGGGGTGTGGCTCTCAGGTGG No data
1116685765_1116685776 16 Left 1116685765 14:48036225-48036247 CCCAGACTGGGTAGTATGTTCAG No data
Right 1116685776 14:48036264-48036286 CTGGGGGTGTGGCTCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116685776 Original CRISPR CTGGGGGTGTGGCTCTCAGG TGG Intergenic
No off target data available for this crispr