ID: 1116691404

View in Genome Browser
Species Human (GRCh38)
Location 14:48111387-48111409
Sequence ATTGATACACAGATGACTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116691402_1116691404 8 Left 1116691402 14:48111356-48111378 CCCACATGTATGTGGAATTAGTA No data
Right 1116691404 14:48111387-48111409 ATTGATACACAGATGACTCTTGG No data
1116691403_1116691404 7 Left 1116691403 14:48111357-48111379 CCACATGTATGTGGAATTAGTAG No data
Right 1116691404 14:48111387-48111409 ATTGATACACAGATGACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116691404 Original CRISPR ATTGATACACAGATGACTCT TGG Intergenic
No off target data available for this crispr