ID: 1116696379

View in Genome Browser
Species Human (GRCh38)
Location 14:48183230-48183252
Sequence TTTTAGCCATAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116696379_1116696386 -3 Left 1116696379 14:48183230-48183252 CCCAGCTCCAGCTATGGCTAAAA No data
Right 1116696386 14:48183250-48183272 AAAGGGGACAAGGTATAGCTAGG No data
1116696379_1116696388 13 Left 1116696379 14:48183230-48183252 CCCAGCTCCAGCTATGGCTAAAA No data
Right 1116696388 14:48183266-48183288 AGCTAGGCTGTGGCTTTAGAAGG No data
1116696379_1116696387 3 Left 1116696379 14:48183230-48183252 CCCAGCTCCAGCTATGGCTAAAA No data
Right 1116696387 14:48183256-48183278 GACAAGGTATAGCTAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116696379 Original CRISPR TTTTAGCCATAGCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr