ID: 1116702757

View in Genome Browser
Species Human (GRCh38)
Location 14:48261264-48261286
Sequence GCAGAGTGAAATATTTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116702756_1116702757 13 Left 1116702756 14:48261228-48261250 CCGACTTTTACTCGAAATCATGC No data
Right 1116702757 14:48261264-48261286 GCAGAGTGAAATATTTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116702757 Original CRISPR GCAGAGTGAAATATTTTAAG TGG Intergenic
No off target data available for this crispr