ID: 1116706282

View in Genome Browser
Species Human (GRCh38)
Location 14:48305972-48305994
Sequence TCAGGGCAGCCAACTCCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116706282_1116706286 14 Left 1116706282 14:48305972-48305994 CCTAAAGGAGTTGGCTGCCCTGA No data
Right 1116706286 14:48306009-48306031 AGAACTCTTTGTTTTATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116706282 Original CRISPR TCAGGGCAGCCAACTCCTTT AGG (reversed) Intergenic
No off target data available for this crispr