ID: 1116706283

View in Genome Browser
Species Human (GRCh38)
Location 14:48305989-48306011
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116706283_1116706287 19 Left 1116706283 14:48305989-48306011 CCCTGACTTGCTCATGCCTGAGA No data
Right 1116706287 14:48306031-48306053 GTGTCTGTCCTTGAAAAGTGAGG No data
1116706283_1116706286 -3 Left 1116706283 14:48305989-48306011 CCCTGACTTGCTCATGCCTGAGA No data
Right 1116706286 14:48306009-48306031 AGAACTCTTTGTTTTATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116706283 Original CRISPR TCTCAGGCATGAGCAAGTCA GGG (reversed) Intergenic
No off target data available for this crispr