ID: 1116706284

View in Genome Browser
Species Human (GRCh38)
Location 14:48305990-48306012
Sequence TTCTCAGGCATGAGCAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116706284_1116706287 18 Left 1116706284 14:48305990-48306012 CCTGACTTGCTCATGCCTGAGAA No data
Right 1116706287 14:48306031-48306053 GTGTCTGTCCTTGAAAAGTGAGG No data
1116706284_1116706286 -4 Left 1116706284 14:48305990-48306012 CCTGACTTGCTCATGCCTGAGAA No data
Right 1116706286 14:48306009-48306031 AGAACTCTTTGTTTTATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116706284 Original CRISPR TTCTCAGGCATGAGCAAGTC AGG (reversed) Intergenic
No off target data available for this crispr