ID: 1116706286

View in Genome Browser
Species Human (GRCh38)
Location 14:48306009-48306031
Sequence AGAACTCTTTGTTTTATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116706283_1116706286 -3 Left 1116706283 14:48305989-48306011 CCCTGACTTGCTCATGCCTGAGA No data
Right 1116706286 14:48306009-48306031 AGAACTCTTTGTTTTATGCATGG No data
1116706280_1116706286 25 Left 1116706280 14:48305961-48305983 CCTACTCAAGACCTAAAGGAGTT No data
Right 1116706286 14:48306009-48306031 AGAACTCTTTGTTTTATGCATGG No data
1116706284_1116706286 -4 Left 1116706284 14:48305990-48306012 CCTGACTTGCTCATGCCTGAGAA No data
Right 1116706286 14:48306009-48306031 AGAACTCTTTGTTTTATGCATGG No data
1116706282_1116706286 14 Left 1116706282 14:48305972-48305994 CCTAAAGGAGTTGGCTGCCCTGA No data
Right 1116706286 14:48306009-48306031 AGAACTCTTTGTTTTATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116706286 Original CRISPR AGAACTCTTTGTTTTATGCA TGG Intergenic
No off target data available for this crispr