ID: 1116706402

View in Genome Browser
Species Human (GRCh38)
Location 14:48307791-48307813
Sequence CTGCAGTTACCACTATCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116706402_1116706407 -7 Left 1116706402 14:48307791-48307813 CCCTTGGATAGTGGTAACTGCAG No data
Right 1116706407 14:48307807-48307829 ACTGCAGAAACATTTGGGGCTGG No data
1116706402_1116706409 12 Left 1116706402 14:48307791-48307813 CCCTTGGATAGTGGTAACTGCAG No data
Right 1116706409 14:48307826-48307848 CTGGGAAATAAATTCGTATCTGG No data
1116706402_1116706408 -6 Left 1116706402 14:48307791-48307813 CCCTTGGATAGTGGTAACTGCAG No data
Right 1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG No data
1116706402_1116706410 19 Left 1116706402 14:48307791-48307813 CCCTTGGATAGTGGTAACTGCAG No data
Right 1116706410 14:48307833-48307855 ATAAATTCGTATCTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116706402 Original CRISPR CTGCAGTTACCACTATCCAA GGG (reversed) Intergenic
No off target data available for this crispr