ID: 1116706403

View in Genome Browser
Species Human (GRCh38)
Location 14:48307792-48307814
Sequence TCTGCAGTTACCACTATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116706403_1116706408 -7 Left 1116706403 14:48307792-48307814 CCTTGGATAGTGGTAACTGCAGA No data
Right 1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG No data
1116706403_1116706407 -8 Left 1116706403 14:48307792-48307814 CCTTGGATAGTGGTAACTGCAGA No data
Right 1116706407 14:48307807-48307829 ACTGCAGAAACATTTGGGGCTGG No data
1116706403_1116706410 18 Left 1116706403 14:48307792-48307814 CCTTGGATAGTGGTAACTGCAGA No data
Right 1116706410 14:48307833-48307855 ATAAATTCGTATCTGGAGTGAGG No data
1116706403_1116706409 11 Left 1116706403 14:48307792-48307814 CCTTGGATAGTGGTAACTGCAGA No data
Right 1116706409 14:48307826-48307848 CTGGGAAATAAATTCGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116706403 Original CRISPR TCTGCAGTTACCACTATCCA AGG (reversed) Intergenic