ID: 1116706407

View in Genome Browser
Species Human (GRCh38)
Location 14:48307807-48307829
Sequence ACTGCAGAAACATTTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116706402_1116706407 -7 Left 1116706402 14:48307791-48307813 CCCTTGGATAGTGGTAACTGCAG No data
Right 1116706407 14:48307807-48307829 ACTGCAGAAACATTTGGGGCTGG No data
1116706403_1116706407 -8 Left 1116706403 14:48307792-48307814 CCTTGGATAGTGGTAACTGCAGA No data
Right 1116706407 14:48307807-48307829 ACTGCAGAAACATTTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116706407 Original CRISPR ACTGCAGAAACATTTGGGGC TGG Intergenic
No off target data available for this crispr