ID: 1116707338

View in Genome Browser
Species Human (GRCh38)
Location 14:48318963-48318985
Sequence CCCCAGCCTGGGTCTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116707338_1116707343 14 Left 1116707338 14:48318963-48318985 CCACAGGGAGACCCAGGCTGGGG No data
Right 1116707343 14:48319000-48319022 TTGCAAAAGTCCGTGTTCTCTGG No data
1116707338_1116707344 15 Left 1116707338 14:48318963-48318985 CCACAGGGAGACCCAGGCTGGGG No data
Right 1116707344 14:48319001-48319023 TGCAAAAGTCCGTGTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116707338 Original CRISPR CCCCAGCCTGGGTCTCCCTG TGG (reversed) Intergenic