ID: 1116713196

View in Genome Browser
Species Human (GRCh38)
Location 14:48396114-48396136
Sequence TGGTAATTCTCAATGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116713193_1116713196 -8 Left 1116713193 14:48396099-48396121 CCAAATCAAATCAAATGGTAATT No data
Right 1116713196 14:48396114-48396136 TGGTAATTCTCAATGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116713196 Original CRISPR TGGTAATTCTCAATGTTGGA GGG Intergenic
No off target data available for this crispr