ID: 1116725265

View in Genome Browser
Species Human (GRCh38)
Location 14:48554767-48554789
Sequence CAGCAGCAGCAGCAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116725265_1116725272 -7 Left 1116725265 14:48554767-48554789 CCACTCTGCTGCTGCTGCTGCTG No data
Right 1116725272 14:48554783-48554805 GCTGCTGCTGGGGGTGTGGGAGG No data
1116725265_1116725275 -2 Left 1116725265 14:48554767-48554789 CCACTCTGCTGCTGCTGCTGCTG No data
Right 1116725275 14:48554788-48554810 TGCTGGGGGTGTGGGAGGGGTGG No data
1116725265_1116725273 -6 Left 1116725265 14:48554767-48554789 CCACTCTGCTGCTGCTGCTGCTG No data
Right 1116725273 14:48554784-48554806 CTGCTGCTGGGGGTGTGGGAGGG No data
1116725265_1116725276 13 Left 1116725265 14:48554767-48554789 CCACTCTGCTGCTGCTGCTGCTG No data
Right 1116725276 14:48554803-48554825 AGGGGTGGCATCAGCAATTCAGG No data
1116725265_1116725271 -10 Left 1116725265 14:48554767-48554789 CCACTCTGCTGCTGCTGCTGCTG No data
Right 1116725271 14:48554780-48554802 GCTGCTGCTGCTGGGGGTGTGGG No data
1116725265_1116725274 -5 Left 1116725265 14:48554767-48554789 CCACTCTGCTGCTGCTGCTGCTG No data
Right 1116725274 14:48554785-48554807 TGCTGCTGGGGGTGTGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116725265 Original CRISPR CAGCAGCAGCAGCAGCAGAG TGG (reversed) Intergenic
No off target data available for this crispr