ID: 1116725624

View in Genome Browser
Species Human (GRCh38)
Location 14:48558391-48558413
Sequence ATACCCTTATAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116725622_1116725624 2 Left 1116725622 14:48558366-48558388 CCATGGATAAAGGACCTAACAAA No data
Right 1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG No data
1116725620_1116725624 18 Left 1116725620 14:48558350-48558372 CCTCTTTTACTTTAAACCATGGA No data
Right 1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116725624 Original CRISPR ATACCCTTATAGAAGAGTGA AGG Intergenic
No off target data available for this crispr