ID: 1116725704

View in Genome Browser
Species Human (GRCh38)
Location 14:48559179-48559201
Sequence ACCTAGGAGAAACTCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116725700_1116725704 -3 Left 1116725700 14:48559159-48559181 CCACACAAAGGTCCAACCAGACC No data
Right 1116725704 14:48559179-48559201 ACCTAGGAGAAACTCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116725704 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG Intergenic
No off target data available for this crispr