ID: 1116736176

View in Genome Browser
Species Human (GRCh38)
Location 14:48694963-48694985
Sequence GGTGACTTAACAGCAAAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116736176_1116736180 17 Left 1116736176 14:48694963-48694985 CCGGTCTTTGCTGTTAAGTCACC No data
Right 1116736180 14:48695003-48695025 CAGGGTTACCATTGCTTTTTAGG No data
1116736176_1116736178 -2 Left 1116736176 14:48694963-48694985 CCGGTCTTTGCTGTTAAGTCACC No data
Right 1116736178 14:48694984-48695006 CCTGTTAAGTATCAGTACTCAGG No data
1116736176_1116736179 -1 Left 1116736176 14:48694963-48694985 CCGGTCTTTGCTGTTAAGTCACC No data
Right 1116736179 14:48694985-48695007 CTGTTAAGTATCAGTACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116736176 Original CRISPR GGTGACTTAACAGCAAAGAC CGG (reversed) Intergenic
No off target data available for this crispr