ID: 1116736179

View in Genome Browser
Species Human (GRCh38)
Location 14:48694985-48695007
Sequence CTGTTAAGTATCAGTACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116736175_1116736179 0 Left 1116736175 14:48694962-48694984 CCCGGTCTTTGCTGTTAAGTCAC No data
Right 1116736179 14:48694985-48695007 CTGTTAAGTATCAGTACTCAGGG No data
1116736176_1116736179 -1 Left 1116736176 14:48694963-48694985 CCGGTCTTTGCTGTTAAGTCACC No data
Right 1116736179 14:48694985-48695007 CTGTTAAGTATCAGTACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116736179 Original CRISPR CTGTTAAGTATCAGTACTCA GGG Intergenic
No off target data available for this crispr