ID: 1116736180

View in Genome Browser
Species Human (GRCh38)
Location 14:48695003-48695025
Sequence CAGGGTTACCATTGCTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116736176_1116736180 17 Left 1116736176 14:48694963-48694985 CCGGTCTTTGCTGTTAAGTCACC No data
Right 1116736180 14:48695003-48695025 CAGGGTTACCATTGCTTTTTAGG No data
1116736175_1116736180 18 Left 1116736175 14:48694962-48694984 CCCGGTCTTTGCTGTTAAGTCAC No data
Right 1116736180 14:48695003-48695025 CAGGGTTACCATTGCTTTTTAGG No data
1116736177_1116736180 -4 Left 1116736177 14:48694984-48695006 CCTGTTAAGTATCAGTACTCAGG No data
Right 1116736180 14:48695003-48695025 CAGGGTTACCATTGCTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116736180 Original CRISPR CAGGGTTACCATTGCTTTTT AGG Intergenic
No off target data available for this crispr