ID: 1116740324

View in Genome Browser
Species Human (GRCh38)
Location 14:48746699-48746721
Sequence CAACAAACAACAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116740324_1116740333 23 Left 1116740324 14:48746699-48746721 CCATCCACCACTGTTGTTTGTTG No data
Right 1116740333 14:48746745-48746767 CCCATCCCTCCAGATCCAGCAGG No data
1116740324_1116740335 24 Left 1116740324 14:48746699-48746721 CCATCCACCACTGTTGTTTGTTG No data
Right 1116740335 14:48746746-48746768 CCATCCCTCCAGATCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116740324 Original CRISPR CAACAAACAACAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr