ID: 1116740543

View in Genome Browser
Species Human (GRCh38)
Location 14:48748946-48748968
Sequence TACCTATTCTTGGCTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116740538_1116740543 29 Left 1116740538 14:48748894-48748916 CCTAATAAAATAATCTTACTGGT No data
Right 1116740543 14:48748946-48748968 TACCTATTCTTGGCTACTCCAGG No data
1116740540_1116740543 -4 Left 1116740540 14:48748927-48748949 CCAGCTTTCCACACTGGTTTACC No data
Right 1116740543 14:48748946-48748968 TACCTATTCTTGGCTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116740543 Original CRISPR TACCTATTCTTGGCTACTCC AGG Intergenic
No off target data available for this crispr