ID: 1116742644

View in Genome Browser
Species Human (GRCh38)
Location 14:48776435-48776457
Sequence AGCCATGGCCATAGTTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116742644_1116742650 2 Left 1116742644 14:48776435-48776457 CCATGCCAACTATGGCCATGGCT No data
Right 1116742650 14:48776460-48776482 AAGGGGCCAAGATATAGCTCAGG No data
1116742644_1116742652 17 Left 1116742644 14:48776435-48776457 CCATGCCAACTATGGCCATGGCT No data
Right 1116742652 14:48776475-48776497 AGCTCAGGCCATTGCTTCAGAGG 0: 229
1: 567
2: 911
3: 1254
4: 1342
1116742644_1116742653 18 Left 1116742644 14:48776435-48776457 CCATGCCAACTATGGCCATGGCT No data
Right 1116742653 14:48776476-48776498 GCTCAGGCCATTGCTTCAGAGGG 0: 228
1: 554
2: 874
3: 1224
4: 1332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116742644 Original CRISPR AGCCATGGCCATAGTTGGCA TGG (reversed) Intergenic
No off target data available for this crispr