ID: 1116749851

View in Genome Browser
Species Human (GRCh38)
Location 14:48869480-48869502
Sequence GAAAATTCAAAGAAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116749844_1116749851 8 Left 1116749844 14:48869449-48869471 CCCAAGCCTCAAGGTGAGAAGCA No data
Right 1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG No data
1116749841_1116749851 19 Left 1116749841 14:48869438-48869460 CCCAGGTGAGACCCAAGCCTCAA No data
Right 1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG No data
1116749842_1116749851 18 Left 1116749842 14:48869439-48869461 CCAGGTGAGACCCAAGCCTCAAG No data
Right 1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG No data
1116749845_1116749851 7 Left 1116749845 14:48869450-48869472 CCAAGCCTCAAGGTGAGAAGCAC No data
Right 1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG No data
1116749846_1116749851 2 Left 1116749846 14:48869455-48869477 CCTCAAGGTGAGAAGCACACCTT No data
Right 1116749851 14:48869480-48869502 GAAAATTCAAAGAAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116749851 Original CRISPR GAAAATTCAAAGAAGCAGCA GGG Intergenic
No off target data available for this crispr