ID: 1116752054

View in Genome Browser
Species Human (GRCh38)
Location 14:48899087-48899109
Sequence CAAGCAACTCTCCTGGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116752048_1116752054 22 Left 1116752048 14:48899042-48899064 CCATAAGAGAAGTATAGCATTGG No data
Right 1116752054 14:48899087-48899109 CAAGCAACTCTCCTGGGAATGGG No data
1116752047_1116752054 23 Left 1116752047 14:48899041-48899063 CCCATAAGAGAAGTATAGCATTG No data
Right 1116752054 14:48899087-48899109 CAAGCAACTCTCCTGGGAATGGG No data
1116752050_1116752054 -1 Left 1116752050 14:48899065-48899087 CCAGCAAGAGTATATTGCACATC No data
Right 1116752054 14:48899087-48899109 CAAGCAACTCTCCTGGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116752054 Original CRISPR CAAGCAACTCTCCTGGGAAT GGG Intergenic
No off target data available for this crispr