ID: 1116756275

View in Genome Browser
Species Human (GRCh38)
Location 14:48952600-48952622
Sequence GACACAGAAGTGACTCCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116756275_1116756277 2 Left 1116756275 14:48952600-48952622 CCTAAAGGAGTCACTTCTGTGTC No data
Right 1116756277 14:48952625-48952647 AGCCCTGCAGTACTTGAAGGTGG No data
1116756275_1116756276 -1 Left 1116756275 14:48952600-48952622 CCTAAAGGAGTCACTTCTGTGTC No data
Right 1116756276 14:48952622-48952644 CTCAGCCCTGCAGTACTTGAAGG No data
1116756275_1116756278 3 Left 1116756275 14:48952600-48952622 CCTAAAGGAGTCACTTCTGTGTC No data
Right 1116756278 14:48952626-48952648 GCCCTGCAGTACTTGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116756275 Original CRISPR GACACAGAAGTGACTCCTTT AGG (reversed) Intergenic