ID: 1116756276

View in Genome Browser
Species Human (GRCh38)
Location 14:48952622-48952644
Sequence CTCAGCCCTGCAGTACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116756275_1116756276 -1 Left 1116756275 14:48952600-48952622 CCTAAAGGAGTCACTTCTGTGTC No data
Right 1116756276 14:48952622-48952644 CTCAGCCCTGCAGTACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116756276 Original CRISPR CTCAGCCCTGCAGTACTTGA AGG Intergenic
No off target data available for this crispr