ID: 1116756510

View in Genome Browser
Species Human (GRCh38)
Location 14:48955357-48955379
Sequence GTCCCTCTATTGACTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116756510_1116756514 4 Left 1116756510 14:48955357-48955379 CCAGCTCCAGTCAATAGAGGGAC No data
Right 1116756514 14:48955384-48955406 GGCAACTCCTCTGTGGTTTCTGG No data
1116756510_1116756513 -3 Left 1116756510 14:48955357-48955379 CCAGCTCCAGTCAATAGAGGGAC No data
Right 1116756513 14:48955377-48955399 GACAACAGGCAACTCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116756510 Original CRISPR GTCCCTCTATTGACTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr