ID: 1116756513

View in Genome Browser
Species Human (GRCh38)
Location 14:48955377-48955399
Sequence GACAACAGGCAACTCCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116756510_1116756513 -3 Left 1116756510 14:48955357-48955379 CCAGCTCCAGTCAATAGAGGGAC No data
Right 1116756513 14:48955377-48955399 GACAACAGGCAACTCCTCTGTGG No data
1116756511_1116756513 -9 Left 1116756511 14:48955363-48955385 CCAGTCAATAGAGGGACAACAGG No data
Right 1116756513 14:48955377-48955399 GACAACAGGCAACTCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116756513 Original CRISPR GACAACAGGCAACTCCTCTG TGG Intergenic
No off target data available for this crispr