ID: 1116757162

View in Genome Browser
Species Human (GRCh38)
Location 14:48962357-48962379
Sequence ATGCTGTTATATATCATACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116757160_1116757162 16 Left 1116757160 14:48962318-48962340 CCACAAAAAAAGGAGGAGTGGGA No data
Right 1116757162 14:48962357-48962379 ATGCTGTTATATATCATACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116757162 Original CRISPR ATGCTGTTATATATCATACA CGG Intergenic
No off target data available for this crispr