ID: 1116758567

View in Genome Browser
Species Human (GRCh38)
Location 14:48980941-48980963
Sequence GGACTTTGGTATCAGGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116758567_1116758572 -4 Left 1116758567 14:48980941-48980963 CCACATTCCTGATACCAAAGTCC No data
Right 1116758572 14:48980960-48980982 GTCCTTAAGGGTTTCAAGAGTGG No data
1116758567_1116758574 10 Left 1116758567 14:48980941-48980963 CCACATTCCTGATACCAAAGTCC No data
Right 1116758574 14:48980974-48980996 CAAGAGTGGAAGTATATTCCAGG No data
1116758567_1116758575 11 Left 1116758567 14:48980941-48980963 CCACATTCCTGATACCAAAGTCC No data
Right 1116758575 14:48980975-48980997 AAGAGTGGAAGTATATTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116758567 Original CRISPR GGACTTTGGTATCAGGAATG TGG (reversed) Intergenic
No off target data available for this crispr