ID: 1116758569

View in Genome Browser
Species Human (GRCh38)
Location 14:48980948-48980970
Sequence CCCTTAAGGACTTTGGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116758569_1116758575 4 Left 1116758569 14:48980948-48980970 CCTGATACCAAAGTCCTTAAGGG No data
Right 1116758575 14:48980975-48980997 AAGAGTGGAAGTATATTCCAGGG No data
1116758569_1116758574 3 Left 1116758569 14:48980948-48980970 CCTGATACCAAAGTCCTTAAGGG No data
Right 1116758574 14:48980974-48980996 CAAGAGTGGAAGTATATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116758569 Original CRISPR CCCTTAAGGACTTTGGTATC AGG (reversed) Intergenic
No off target data available for this crispr