ID: 1116758571

View in Genome Browser
Species Human (GRCh38)
Location 14:48980955-48980977
Sequence CTTGAAACCCTTAAGGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116758571_1116758574 -4 Left 1116758571 14:48980955-48980977 CCAAAGTCCTTAAGGGTTTCAAG No data
Right 1116758574 14:48980974-48980996 CAAGAGTGGAAGTATATTCCAGG No data
1116758571_1116758575 -3 Left 1116758571 14:48980955-48980977 CCAAAGTCCTTAAGGGTTTCAAG No data
Right 1116758575 14:48980975-48980997 AAGAGTGGAAGTATATTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116758571 Original CRISPR CTTGAAACCCTTAAGGACTT TGG (reversed) Intergenic
No off target data available for this crispr