ID: 1116758573

View in Genome Browser
Species Human (GRCh38)
Location 14:48980962-48980984
Sequence TTCCACTCTTGAAACCCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116758573_1116758575 -10 Left 1116758573 14:48980962-48980984 CCTTAAGGGTTTCAAGAGTGGAA No data
Right 1116758575 14:48980975-48980997 AAGAGTGGAAGTATATTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116758573 Original CRISPR TTCCACTCTTGAAACCCTTA AGG (reversed) Intergenic
No off target data available for this crispr