ID: 1116758574

View in Genome Browser
Species Human (GRCh38)
Location 14:48980974-48980996
Sequence CAAGAGTGGAAGTATATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116758569_1116758574 3 Left 1116758569 14:48980948-48980970 CCTGATACCAAAGTCCTTAAGGG No data
Right 1116758574 14:48980974-48980996 CAAGAGTGGAAGTATATTCCAGG No data
1116758571_1116758574 -4 Left 1116758571 14:48980955-48980977 CCAAAGTCCTTAAGGGTTTCAAG No data
Right 1116758574 14:48980974-48980996 CAAGAGTGGAAGTATATTCCAGG No data
1116758567_1116758574 10 Left 1116758567 14:48980941-48980963 CCACATTCCTGATACCAAAGTCC No data
Right 1116758574 14:48980974-48980996 CAAGAGTGGAAGTATATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116758574 Original CRISPR CAAGAGTGGAAGTATATTCC AGG Intergenic
No off target data available for this crispr