ID: 1116758575

View in Genome Browser
Species Human (GRCh38)
Location 14:48980975-48980997
Sequence AAGAGTGGAAGTATATTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116758571_1116758575 -3 Left 1116758571 14:48980955-48980977 CCAAAGTCCTTAAGGGTTTCAAG No data
Right 1116758575 14:48980975-48980997 AAGAGTGGAAGTATATTCCAGGG No data
1116758569_1116758575 4 Left 1116758569 14:48980948-48980970 CCTGATACCAAAGTCCTTAAGGG No data
Right 1116758575 14:48980975-48980997 AAGAGTGGAAGTATATTCCAGGG No data
1116758573_1116758575 -10 Left 1116758573 14:48980962-48980984 CCTTAAGGGTTTCAAGAGTGGAA No data
Right 1116758575 14:48980975-48980997 AAGAGTGGAAGTATATTCCAGGG No data
1116758567_1116758575 11 Left 1116758567 14:48980941-48980963 CCACATTCCTGATACCAAAGTCC No data
Right 1116758575 14:48980975-48980997 AAGAGTGGAAGTATATTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116758575 Original CRISPR AAGAGTGGAAGTATATTCCA GGG Intergenic
No off target data available for this crispr