ID: 1116759877

View in Genome Browser
Species Human (GRCh38)
Location 14:48998812-48998834
Sequence GTACCCTCCCAGATTAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116759877_1116759881 5 Left 1116759877 14:48998812-48998834 CCACCCTTAATCTGGGAGGGTAC No data
Right 1116759881 14:48998840-48998862 AATCAGCTGCCAGCACGGCTAGG No data
1116759877_1116759880 0 Left 1116759877 14:48998812-48998834 CCACCCTTAATCTGGGAGGGTAC No data
Right 1116759880 14:48998835-48998857 AATCTAATCAGCTGCCAGCACGG 0: 121
1: 425
2: 533
3: 570
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116759877 Original CRISPR GTACCCTCCCAGATTAAGGG TGG (reversed) Intergenic
No off target data available for this crispr