ID: 1116760343

View in Genome Browser
Species Human (GRCh38)
Location 14:49005405-49005427
Sequence TGTCAGCCCATAATATAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116760343_1116760347 18 Left 1116760343 14:49005405-49005427 CCTTGTTATATTATGGGCTGACA No data
Right 1116760347 14:49005446-49005468 TGTACTGAGTCTACAGCTGTGGG No data
1116760343_1116760350 30 Left 1116760343 14:49005405-49005427 CCTTGTTATATTATGGGCTGACA No data
Right 1116760350 14:49005458-49005480 ACAGCTGTGGGAACTTGGTTGGG No data
1116760343_1116760348 25 Left 1116760343 14:49005405-49005427 CCTTGTTATATTATGGGCTGACA No data
Right 1116760348 14:49005453-49005475 AGTCTACAGCTGTGGGAACTTGG No data
1116760343_1116760346 17 Left 1116760343 14:49005405-49005427 CCTTGTTATATTATGGGCTGACA No data
Right 1116760346 14:49005445-49005467 ATGTACTGAGTCTACAGCTGTGG No data
1116760343_1116760349 29 Left 1116760343 14:49005405-49005427 CCTTGTTATATTATGGGCTGACA No data
Right 1116760349 14:49005457-49005479 TACAGCTGTGGGAACTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116760343 Original CRISPR TGTCAGCCCATAATATAACA AGG (reversed) Intergenic
No off target data available for this crispr