ID: 1116760347

View in Genome Browser
Species Human (GRCh38)
Location 14:49005446-49005468
Sequence TGTACTGAGTCTACAGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116760343_1116760347 18 Left 1116760343 14:49005405-49005427 CCTTGTTATATTATGGGCTGACA No data
Right 1116760347 14:49005446-49005468 TGTACTGAGTCTACAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116760347 Original CRISPR TGTACTGAGTCTACAGCTGT GGG Intergenic
No off target data available for this crispr